KIAA0795

Product ID	ORK05760
Accession No	AB018338
Description	kelch-like family member 18
Clone name	hk06104
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4273 bp) Predicted protein sequence (465 aa)
Source	Human adult brain
Rouge ID	mKIAA0795 by Kazusa Mouse cDNA Project

Length: 4273 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2874 bp
Genome contig ID	gi89161205f_47239128
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGAAACCAAAGAGAAATAAAGAGAACACTCCTAAT
Flanking genome sequence (124183 - 124232)	----+--------+--------+--------+--------+----* AGCTCTTGTCCTTTCTTGGTTTATTTCTCAGATATTAGAAGTACATGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	47339128	47363309	8	99.2	Perfect prediction

Length: 465 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB93503	1e-207	100.0	OK/SW-CL.74 [Ho...	Homo sapiens
O94889	1.1e-207	100.0	Kelch-like prot...	Homo sapiens
CAD97920	1.1e-207	100.0	hypothetical pr...	Homo sapiens
BAG58276	1e-206	100.0	unnamed protein...	Homo sapiens
XP_001100798	4.8e-205	99.4	similar to kelc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032955	2.1e-71	39.1	KIAA1129
AB037799	4.5e-63	34.9	KIAA1378
D50922	1.4e-58	35.7	KIAA0132
AB067508	2.3e-46	32.1	KIAA1921
AB037730	2.1e-44	31.7	KIAA1309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	273	286	PR00501	Kelch
	IPR006651	290	304	PR00501	Kelch
	IPR006651	305	317	PR00501	Kelch
HMMPfam	IPR011705	31	133	PF07707	BTB/Kelch-associated
	IPR006652	168	214	PF01344	Kelch repeat type 1
	IPR006652	216	261	PF01344	Kelch repeat type 1
	IPR006652	263	308	PF01344	Kelch repeat type 1
	IPR006652	310	355	PF01344	Kelch repeat type 1
	IPR006652	357	402	PF01344	Kelch repeat type 1
	IPR006652	404	449	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	180	227	SM00612	Kelch repeat type 1
	IPR006652	228	274	SM00612	Kelch repeat type 1
	IPR006652	275	321	SM00612	Kelch repeat type 1
	IPR006652	322	368	SM00612	Kelch repeat type 1
	IPR006652	369	415	SM00612	Kelch repeat type 1
	IPR006652	416	462	SM00612	Kelch repeat type 1

Primer_f	GGATGTAACAAGGAGATAGGG
Primer_r	ATCCAGAAGAGAAGGCCCGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-