KIAA0773

Product ID	ORK04953
Accession No	AB018316
Description	family with sequence similarity 131, member B
Clone name	hk05140
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4164 bp) Predicted protein sequence (336 aa)
Source	Human adult brain

Length: 4164 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3149 bp
Genome contig ID	gi89161213r_142660616
PolyA signal sequence (ACTAAA,-20)	+--------+--------+----*----+---- GCTGTGTTCAATGACACTAAACAGAATGTGGTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCCTCTGACTGTGAGTGTCTTATTTGGGGGATGGAGGAGACTGGGAACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	142760616	142766972	6	99.1	Perfect prediction

Length: 336 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10379	4.3e-118	99.0	FAM131B protein...	synthetic construct
XP_001091747	3.4e-117	98.0	hypothetical pr...	Macaca mulatta
CAD89938	3.9e-117	98.4	hypothetical pr...	Homo sapiens
AAH45611	6.9e-117	98.0	Family with seq...	Homo sapiens
XP_001091526	4e-116	99.0	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TAGACCACAGCAGCTTTCGTT
Primer_r	CAGCACCAGAAGAGTCCTAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 7

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTCTAGCAGGGTTCATACATG
Primer_r	CAGCACCAGAAGAGTCCTAAG
PCR product length	163 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles