KIAA0752

Product ID	ORK00621
Accession No	AB018295
Description	family with sequence similarity 153, member A
Clone name	hk04439
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4332 bp) Predicted protein sequence (334 aa)
HaloTag ORF Clone	FHC00621
Flexi ORF Clone	FXC00621
Source	Human adult brain

Length: 4332 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3326 bp
Genome contig ID	gi51511721r_176970843
PolyA signal sequence (ATTAAA,-15)	+--------+--------+----*----+---- TTTCATATTCCGTTTAAAAAATTAAAATTTTACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGACCAATGTCTTCTTTTCAATTCCAGTACAGTCTTCAGAAGTAACTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	175423357	175486564	27	98.2	Perfect prediction
Ensembl gnome browser	5	r	177070843	177140072	27	99.0	Perfect prediction

Length: 334 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P0C7A2	3.5e-119	98.5	Protein FAM153B.	Homo sapiens
Q9UHL3	2.9e-114	100.0	Protein FAM153A...	Homo sapiens
BAF82207	1.3e-113	99.7	unnamed protein...	Homo sapiens
AAI66656	7e-113	99.0	Family with seq...	synthetic construct
XP_001134706	1.3e-103	95.0	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GCTTCTCCAGTCATTTCTTGC
Primer_r	CCAAGTTATCAGGACAAGACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 8

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GCTTCTCCAGTCATTTCTTGC
Primer_r	CCAAGTTATCAGGACAAGACC
PCR product length	147 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles