KIAA0954

Product ID	ORK04311
Accession No	AB023171
Description	myelin regulatory factor
Clone name	hj05543s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5926 bp) Predicted protein sequence (1183 aa)
Source	Human adult brain
Note	We replaced hj05543, former representative clones for KIAA0954 with hj05543s1. (2002/5/10)

Length: 5926 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2374 bp
Genome contig ID	gi51511727f_61176697
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- ATATAAATAAATGTATAAATACTGCTTTGTATCTG
Flanking genome sequence (135870 - 135919)	----+--------+--------+--------+--------+----* AGCTTGCCTCCTTGTCTCTTCTTGGGATTGGTCTGGTGGGAGAGGAGTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	61276697	61312565	27	100.0	Perfect prediction

Length: 1183 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2G1	100.0	Uncharacterized...	Homo sapiens
XP_001116657	98.0	similar to CG33...	Macaca mulatta
XP_540915	91.7	similar to CG33...	Canis lupus fam...
Q3UR85	88.8	Uncharacterized...	Mus musculus
AAF28400	97.2	C11orf9 [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007888	425	572	PF05224	NDT80/PhoG like DNA-binding

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	800	TIIALVVVMAFSVVSMSTLYVLS	822	PRIMARY	23

Primer_f	GTTTGTTCCTGTAGTCACTGG
Primer_r	CACATGACAAATACCAAGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-