KIAA0574

Product ID	ORK05612
Accession No	AB011146
Description	family with sequence similarity 189, member A1
Clone name	hj00204
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4305 bp) Predicted protein sequence (405 aa)
Source	Human adult brain
Rouge ID	mKIAA0574 by Kazusa Mouse cDNA Project

Length: 4305 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3085 bp
Genome contig ID	gi51511731r_27099749
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGATCCGTGTTTTAATAAAAAGAAGTATTTCTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCTCTGTGTCTCTGAGGTCTAACTGGGACAGAGGCAGGCTGAGAGGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	27199749	27276047	8	99.1	Perfect prediction

Length: 405 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW51514	1.1e-117	100.0	hCG27623 [Homo ...	Homo sapiens
NP_056122	7.1e-117	99.5	hypothetical pr...	Homo sapiens
XP_001115936	8.5e-109	93.6	hypothetical pr...	Macaca mulatta
AAI21477	2.8e-46	49.1	Hypothetical pr...	Xenopus (Silura...
XP_413772	1.2e-44	48.3	hypothetical pr...	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	43	LFSVCALNVLSTIVCALATAMCC	65	PRIMARY	23

Primer_f	TGTGTAGCGAGCTTTCTGTGG
Primer_r	CTATGGCAAGCAAGATCGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGTGTAGCGAGCTTTCTGTGG
Primer_r	CTATGGCAAGCAAGATCGCAG
PCR product length	125 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles