|
Order Kazusa clone(s) from : |
| Product ID | ORK00544 |
|---|---|
| Accession No | AB007939 |
| Description | centrosomal protein 170kDa, transcript variant gamma |
| Clone name | hg01996 |
| Vector information | |
| cDNA sequence | DNA sequence (6456 bp) Predicted protein sequence (1472 aa) |
|
HaloTag ORF Clone |
FHC00544
|
| Flexi ORF Clone | FXC00544 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0470
by Kazusa Mouse cDNA Project
|
Length: 6456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 1472 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | ACATCCTGGTTTTTGGTGAGC |
| Primer_r | ACACTACGAGACTGCAACATG |
| PCR product length | 107 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |