KIAA1958

Gene/Protein Characteristic Table for KIAA1958

Order Kazusa clone(s) from :

Product ID	ORK05732
Accession No	AB075838
Description	KIAA1958
Clone name	ha04850
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7056 bp) Predicted protein sequence (607 aa)
Source	Myeloblast cell line (KG-1)

Features of the cloned cDNA sequence

Description

Length: 7056 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5230 bp
Genome contig ID	gi89161216f_114276507
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACTGATTTTTTCAAATAAAAATTTCTAGAAGGCTC
Flanking genome sequence (190895 - 190944)	----+--------+--------+--------+--------+----* AGATTTGACTAAGACTGTGTTACGTGCTTTCTCACAGCTGCCATATATTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	114376507	114467400	3	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 607 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_528391	99.8	hypothetical pr...	Pan troglodytes
XP_001103674	99.5	similar to with...	Macaca mulatta
XP_867699	97.5	similar to CG59...	Canis lupus fam...
XP_001916337	97.2	similar to with...	Equus caballus
BAC39905	97.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTAGGGTATCTCTGGCTTCAC
Primer_r	AACTGAGGGAGAAAGGGCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 9

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp