KIAA1937

Product ID	ORK07615
Accession No	AB067524
Description	forkhead-associated (FHA) phosphopeptide binding domain 1
Clone name	fk04595
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3515 bp) Predicted protein sequence (704 aa)
Source	Human fetal brain

Length: 3515 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1400 bp
Genome contig ID	gi89161185f_15440862
PolyA signal sequence (AAGAAA,-18)	+--------+--------+----*----+---- GCACTGGCTGAAAATGAAAGAAAACCTGCAGATTT
Flanking genome sequence (142781 - 142830)	----+--------+--------+--------+--------+----* ACATAATCAGTCCACATGCATTATTCATGGCCTCCCTAGGCACACACAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	15540851	15583641	16	99.8	Terminal No-hit

Length: 704 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI21428	1.2e-180	99.6	forkhead-associ...	Homo sapiens
XP_513048	1.3e-169	95.2	hypothetical pr...	Pan troglodytes
XP_001088330	3.8e-169	92.9	similar to fork...	Macaca mulatta
BAG59474	5.4e-165	99.8	unnamed protein...	Homo sapiens
B1AJZ9	1.1e-164	91.4	Forkhead-associ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13629	2.4e-05	24.1	KIAA0004
AB020673	0.00063	24.2	KIAA0866

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	VLGGLLLLGVAQLGLFLEEK	20	PRIMARY	20

Primer_f	TGCCAGGAGAAGAGGATCAAC
Primer_r	ACTTGGCTCCTGAGGTATGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-