Gene/Protein Characteristic Table for KIAA1806
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07459
Accession No AB058709
Description zinc finger protein 333
Clone name fk00438
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3079 bp)
Predicted protein sequence (481 aa)
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 3079 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1633 bp
Genome contig ID gi42406306f_14587235
PolyA signal sequence
(ATTAAA,-34)		 
+----*----+----*----+----*----+----
AATTAAATATAGATACTGACATTTTTTACATTTCC
Flanking genome sequence
(105537 - 105586)		 
----+----*----+----*----+----*----+----*----+----*
AACAAATTGTTACTTTTATTCTTATAAAGTGATCATCCTTTTCCCTATTA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 14687235 14692770 5 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 481 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW84442 1.4e-204 100.0 zinc finger pro...
 Homo sapiens
Q96JL9 1.5e-204 100.0 Zinc finger pro...
 Homo sapiens
XP_512445 7.6e-203 99.4 zinc finger pro...
 Pan troglodytes
CAI56712 1.6e-202 99.4 hypothetical pr...
 Homo sapiens
XP_001112454 2e-198 96.9 similar to zinc...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037817 2.5e-54 51.6 KIAA1396
AB058755 2.2e-53 49.9 KIAA1852
AB051497 3.6e-53 46.1 KIAA1710
AB037770 8.4e-53 43.7 KIAA1349
AB046831 9.8e-53 49.7 KIAA1611
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 182 205 PD000003 Zinc finger
IPR007087 210 233 PD000003 Zinc finger
IPR007087 238 261 PD000003 Zinc finger
IPR007087 266 289 PD000003 Zinc finger
IPR007087 294 317 PD000003 Zinc finger
IPR007087 322 345 PD000003 Zinc finger
IPR007087 378 401 PD000003 Zinc finger
IPR007087 406 429 PD000003 Zinc finger
IPR007087 434 456 PD000003 Zinc finger
HMMPfam IPR001909 19 59 PF01352 KRAB box
IPR007087 182 204 PF00096 Zinc finger
IPR007087 210 232 PF00096 Zinc finger
IPR007087 238 260 PF00096 Zinc finger
IPR007087 266 288 PF00096 Zinc finger
IPR007087 294 316 PF00096 Zinc finger
IPR007087 322 344 PF00096 Zinc finger
IPR007087 350 372 PF00096 Zinc finger
IPR007087 378 400 PF00096 Zinc finger
IPR007087 406 428 PF00096 Zinc finger
IPR007087 434 456 PF00096 Zinc finger
HMMSmart IPR001909 19 79 SM00349 KRAB box
IPR015880 182 204 SM00355 Zinc finger
IPR003656 192 235 SM00614 Zinc finger
IPR015880 210 232 SM00355 Zinc finger
IPR015880 238 260 SM00355 Zinc finger
IPR015880 266 288 SM00355 Zinc finger
IPR015880 294 316 SM00355 Zinc finger
IPR015880 322 344 SM00355 Zinc finger
IPR003656 331 375 SM00614 Zinc finger
IPR015880 350 372 SM00355 Zinc finger
IPR015880 378 400 SM00355 Zinc finger
IPR015880 406 428 SM00355 Zinc finger
IPR015880 434 456 SM00355 Zinc finger
ProfileScan IPR001909 19 90 PS50805 KRAB box
IPR007087 182 209 PS50157 Zinc finger
IPR007087 210 237 PS50157 Zinc finger
IPR007087 238 265 PS50157 Zinc finger
IPR007087 266 293 PS50157 Zinc finger
IPR007087 294 321 PS50157 Zinc finger
IPR007087 322 349 PS50157 Zinc finger
IPR007087 350 377 PS50157 Zinc finger
IPR007087 378 405 PS50157 Zinc finger
IPR007087 406 433 PS50157 Zinc finger
IPR007087 434 461 PS50157 Zinc finger
ScanRegExp IPR007087 184 204 PS00028 Zinc finger
IPR007087 212 232 PS00028 Zinc finger
IPR007087 240 260 PS00028 Zinc finger
IPR007087 268 288 PS00028 Zinc finger
IPR007087 296 316 PS00028 Zinc finger
IPR007087 324 344 PS00028 Zinc finger
IPR007087 352 372 PS00028 Zinc finger
IPR007087 380 400 PS00028 Zinc finger
IPR007087 408 428 PS00028 Zinc finger
IPR007087 436 456 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGATATTGTGTTCAGGGATGG
Primer_r CAGAAGCAAGATGGTTATGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp