KIAA1595

Product ID	ORK04733
Accession No	AB046815
Description	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Clone name	fj09517
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4033 bp) Predicted protein sequence (471 aa)
Source	Human fetal brain
Rouge ID	mKIAA1595 by Kazusa Mouse cDNA Project

Length: 4033 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	331 bp
Genome contig ID	gi89161190f_122556961
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GCGAGACCCTCTCATTAAAAACAACAAAACAAAAC
Flanking genome sequence (114012 - 114061)	----+--------+--------+--------+--------+----* AATTCCAGTCTTGGAGTAGTCTAACAGAAGAAAATGTAAAATTATTTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	122656881	122670971	9	99.4	Perfect prediction

Length: 471 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW98421	7.9e-168	99.8	DEAD (Asp-Glu-A...	Homo sapiens
XP_001170185	1.5e-167	99.6	DEAD (Asp-Glu-A...	Pan troglodytes
XP_001170205	1.6e-167	99.6	DEAD (Asp-Glu-A...	Pan troglodytes
XP_001170244	1.7e-167	99.6	DEAD (Asp-Glu-A...	Pan troglodytes
XP_001170267	1.8e-167	99.6	DEAD (Asp-Glu-A...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018344	1.6e-12	31.7	KIAA0801
D21853	1.5e-11	29.3	KIAA0111

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	7	83	PF00270	DNA/RNA helicase
HMMPfam	IPR001650	159	234	PF00271	DNA/RNA helicase
HMMSmart	IPR001650	152	234	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	1	94	PS51192	Helicase
ProfileScan	IPR001650	125	273	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	40	48	PS00039	RNA helicase

Primer_f	GAAGGGCGTGAAGATTATGTG
Primer_r	ATTGCTGGGAGGGTCATACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GAAGGGCGTGAAGATTATGTG
Primer_r	ATTGCTGGGAGGGTCATACTG
PCR product length	172(1.2k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles