Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05731 |
---|---|
Accession No | AB075826 |
Description | family with sequence similarity 171, member B |
Clone name | fh17936 |
Vector information | |
cDNA sequence | DNA sequence (5175 bp) Predicted protein sequence (679 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3133 bp |
---|---|
Genome contig ID | gi89161199f_187216455 |
PolyA signal sequence (AATAAA,-16) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (122477 - 122526) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 187313401 | 187338930 | 7 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 207 | VFLTAILGGTIVIVIGFFAVLLC | 229 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | AGACCTAAGCAGCAGTGAGAG |
---|---|
Primer_r | TTCAACAGTGCTTTTCCTTCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |