KIAA1224

Product ID	ORK07431
Accession No	AB033050
Description	zinc finger, MIZ-type containing 1
Clone name	fh02652
Vector information	The cDNA fragment was inserted at the NotI-SalI site of the ... The cDNA fragment was inserted at the NotI-SalI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was ligated at the NotI site and the 3' end of the cDNA was inserted at the SalI site of the vector. The adjacent sequences to the cDNA are as follows: AACCCTCACT AAAGGGAACA AAAGCTGGAG CTCCACCGCG GTG-5' end of cDNA, GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CG-3' end of cDNA.
cDNA sequence	DNA sequence (4860 bp) Predicted protein sequence (997 aa)
Source	Human fetal brain
Note	We replaced fh03906, former representative clones for KIAA1224 with fh02652. (2002/12/27)

Length: 4860 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1865 bp
Genome contig ID	gi89161187f_80573431
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTGTGAATATTTTAGTATCGTCTTTGATAATATT
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	80673431	80744470	20	99.6	Terminal No-hit

Length: 997 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULJ6	100.0	Zinc finger MIZ...	Homo sapiens
XP_001090830	99.9	similar to reti...	Macaca mulatta
XP_521521	99.9	retinoic acid i...	Pan troglodytes
EAW54639	99.4	retinoic acid i...	Homo sapiens
XP_001929466	99.3	zinc finger, MI...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067473	1.7e-52	62.2	KIAA1886

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004181	668	717	PF02891	Zinc finger
ProfileScan	IPR004181	657	734	PS51044	Zinc finger

Primer_f	CCACCCCATGCAGGAAACTAT
Primer_r	CTCCCTACCCCTCTGTTCTGA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-