KIAA1205

Gene/Protein Characteristic Table for KIAA1205

Order Kazusa clone(s) from :

Product ID	ORK00766
Accession No	AB033031
Description	proline rich 12
Clone name	fg03511a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4470 bp) Predicted protein sequence (1217 aa)
HaloTag ORF Clone	FHC00766
Flexi ORF Clone	FXC00766
Source	Human fetal brain
Rouge ID	mKIAA1205 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4470 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	816 bp
Genome contig ID	gi42406306f_54691915
PolyA signal sequence (None)	+--------+--------+----*----+---- AACCAGCCAAACGAAAACCCAACGGCAAACACTTT
Flanking genome sequence (129594 - 129643)	----+--------+--------+--------+--------+----* ACCGGCAGGCTGGAGTGCCTCTGTCCTGCGGCGCTGGAGTGGGTGGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	54790585	54821507	12	98.9	Perfect prediction

Features of the protein sequence

Description

Length: 1217 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULL5	100.0	Proline-rich pr...	Homo sapiens
NP_065770	99.3	proline rich 12...	Homo sapiens
EAW52505	99.7	hCG2045936 [Hom...	Homo sapiens
XP_541492	94.3	similar to CG17...	Canis lupus fam...
XP_608073	92.3	similar to prol...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000637	349	361	PF02178	HMG-I and HMG-Y
HMMPfam	IPR000637	383	395	PF02178	HMG-I and HMG-Y

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

RH mapping information

Description

Chromosome No. 19

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACTGCCCATCCCCCATTGTTG
Primer_r	AGCAAGAGACAAAGGGTAGTG
PCR product length	118 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp