Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05723 |
---|---|
Accession No | AB058761 |
Description | zinc finger protein 469 |
Clone name | ae00147 |
Vector information | |
cDNA sequence | DNA sequence (8855 bp) Predicted protein sequence (2469 aa) |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA1858
by Kazusa Mouse cDNA Project
|
Note | We replaced fh12352, former representative clones for KIAA1858 with ae00147. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1443 bp |
---|---|
Genome contig ID | gi51511732f_86925830 |
PolyA signal sequence (AATATA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (108830 - 108879) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 87025830 | 87034658 | 2 | 99.0 | Internal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 1631 | 1653 | PF00096 | Zinc finger |
IPR007087 | 1853 | 1875 | PF00096 | Zinc finger | |
IPR007087 | 1934 | 1956 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 988 | 1011 | SM00355 | Zinc finger |
IPR015880 | 1631 | 1653 | SM00355 | Zinc finger | |
IPR015880 | 1659 | 1683 | SM00355 | Zinc finger | |
IPR015880 | 1691 | 1713 | SM00355 | Zinc finger | |
IPR015880 | 1853 | 1875 | SM00355 | Zinc finger | |
IPR015880 | 1881 | 1904 | SM00355 | Zinc finger | |
IPR015880 | 1934 | 1956 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 1631 | 1658 | PS50157 | Zinc finger |
IPR007087 | 1853 | 1880 | PS50157 | Zinc finger | |
IPR007087 | 1934 | 1963 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 990 | 1011 | PS00028 | Zinc finger |
IPR007087 | 1633 | 1653 | PS00028 | Zinc finger | |
IPR007087 | 1693 | 1713 | PS00028 | Zinc finger | |
IPR007087 | 1855 | 1875 | PS00028 | Zinc finger | |
IPR007087 | 1883 | 1904 | PS00028 | Zinc finger | |
IPR007087 | 1936 | 1956 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | GCAGCCCTTTTGAGACCACAC |
---|---|
Primer_r | CAACAGCAGCAAGACTAAGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCAGCCCTTTTGAGACCACAC |
Primer_r | CAACAGCAGCAAGACTAAGAG |
PCR product length | 95 bp |
PCR conditions | 15 °C64 sec60 °C30 sec222 cycles |