KIAA1920

Gene/Protein Characteristic Table for KIAA1920

Order Kazusa clone(s) from :

Product ID	ORK05729
Accession No	AB067507
Description	Homo sapiens mRNA for KIAA1920 protein, partial cds.
Clone name	ae00146
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8556 bp) Predicted protein sequence (445 aa)
Source	Human brain (amygdala)

Features of the cloned cDNA sequence

Description

Length: 8556 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2149 bp
Genome contig ID	gi51511731f_80821533
PolyA signal sequence (None)	+--------+--------+----*----+---- TGACCCGTGACCCTCTTCCAAGAACATTCACTCTG
Flanking genome sequence (1922485 - 1922436)	----+--------+--------+--------+--------+----* ATTTCCAGTGTGCCCTGTTTCCCTTTCCAAATGGCTGGAGAGTGGGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	82744018	82757403	4	99.0	Perfect prediction
Ensembl gnome browser	15	f	80921510	80939559	11	97.1	Internal No-hit
Ensembl gnome browser	15	f	80534979	80552975	12	97.0	Internal No-hit
Ensembl gnome browser	15	f	83532010	83550007	13	97.0	Internal No-hit

Features of the protein sequence

Description

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW99239	2.5e-154	85.7	chondroitin sul...	Homo sapiens
Q6UVK1	2.5e-154	85.7	Chondroitin sul...	Homo sapiens
CAA65529	3.5e-154	85.2	melanoma-associ...	Homo sapiens
XP_001144835	5.5e-154	85.7	melanoma-associ...	Pan troglodytes
XP_001106160	6e-147	83.4	similar to mela...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTGTCAGTGATGGCTTGGTTG
Primer_r	TGTTCCAGGATCACCATAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 15

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp