Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05729 |
---|---|
Accession No | AB067507 |
Description | Homo sapiens mRNA for KIAA1920 protein, partial cds. |
Clone name | ae00146 |
Vector information | |
cDNA sequence | DNA sequence (8556 bp) Predicted protein sequence (445 aa) |
Source | Human brain (amygdala) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2149 bp |
---|---|
Genome contig ID | gi51511731f_80821533 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (1922485 - 1922436) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 82744018 | 82757403 | 4 | 99.0 | Perfect prediction |
| 15 | f | 80921510 | 80939559 | 11 | 97.1 | Internal No-hit |
| 15 | f | 80534979 | 80552975 | 12 | 97.0 | Internal No-hit |
| 15 | f | 83532010 | 83550007 | 13 | 97.0 | Internal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
RT-PCR-ELISA |
Primer_f | GTGTCAGTGATGGCTTGGTTG |
---|---|
Primer_r | TGTTCCAGGATCACCATAAGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |