Gene/Protein Characteristic Table for KIAA1947
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07441
Accession No AB075827
Description zinc finger protein 17
Clone name fh23660
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5700 bp)
Predicted protein sequence (608 aa)
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 5700 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 3873 bp
Genome contig ID gi42406306f_62522835
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TGTGCTTTCTTTTTTTCTAGATCGCGAGCGGCCGC
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 62622835 62631608 2 99.0 Terminal No-hit
Features of the protein sequence
Description

Length: 608 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P17021 0 100.0 Zinc finger pro...
 Homo sapiens
AAI52893 0 100.0 Zinc finger pro...
 synthetic construct
EAW72500 0 100.0 zinc finger pro...
 Homo sapiens
BAG54682 0 99.8 unnamed protein...
 Homo sapiens
BAG54604 0 99.8 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 2.2e-91 54.2 KIAA1611
AB075836 1.1e-86 52.6 KIAA1956
AB037770 2.7e-85 45.3 KIAA1349
D31763 4.3e-83 44.1 KIAA0065
AB107355 1.4e-81 45.7 KIAA2033
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 136 159 PD000003 Zinc finger
IPR007087 164 187 PD000003 Zinc finger
IPR007087 192 215 PD000003 Zinc finger
IPR007087 220 243 PD000003 Zinc finger
IPR007087 248 271 PD000003 Zinc finger
IPR007087 276 299 PD000003 Zinc finger
IPR007087 304 327 PD000003 Zinc finger
IPR007087 332 355 PD000003 Zinc finger
IPR007087 360 383 PD000003 Zinc finger
IPR007087 388 411 PD000003 Zinc finger
IPR007087 416 439 PD000003 Zinc finger
IPR007087 444 467 PD000003 Zinc finger
IPR007087 500 523 PD000003 Zinc finger
IPR007087 528 551 PD000003 Zinc finger
IPR007087 556 579 PD000003 Zinc finger
IPR007087 584 607 PD000003 Zinc finger
HMMPfam IPR007087 136 158 PF00096 Zinc finger
IPR007087 164 186 PF00096 Zinc finger
IPR007087 192 214 PF00096 Zinc finger
IPR007087 220 242 PF00096 Zinc finger
IPR007087 248 270 PF00096 Zinc finger
IPR007087 276 298 PF00096 Zinc finger
IPR007087 304 326 PF00096 Zinc finger
IPR007087 332 354 PF00096 Zinc finger
IPR007087 360 382 PF00096 Zinc finger
IPR007087 388 410 PF00096 Zinc finger
IPR007087 416 438 PF00096 Zinc finger
IPR007087 444 466 PF00096 Zinc finger
IPR007087 472 494 PF00096 Zinc finger
IPR007087 500 522 PF00096 Zinc finger
IPR007087 528 550 PF00096 Zinc finger
IPR007087 556 578 PF00096 Zinc finger
IPR007087 584 606 PF00096 Zinc finger
HMMSmart IPR015880 30 52 SM00355 Zinc finger
IPR015880 136 158 SM00355 Zinc finger
IPR015880 164 186 SM00355 Zinc finger
IPR015880 192 214 SM00355 Zinc finger
IPR015880 220 242 SM00355 Zinc finger
IPR015880 248 270 SM00355 Zinc finger
IPR015880 276 298 SM00355 Zinc finger
IPR015880 304 326 SM00355 Zinc finger
IPR015880 332 354 SM00355 Zinc finger
IPR015880 360 382 SM00355 Zinc finger
IPR015880 388 410 SM00355 Zinc finger
IPR015880 416 438 SM00355 Zinc finger
IPR015880 444 466 SM00355 Zinc finger
IPR015880 472 494 SM00355 Zinc finger
IPR015880 500 522 SM00355 Zinc finger
IPR015880 528 550 SM00355 Zinc finger
IPR015880 556 578 SM00355 Zinc finger
IPR015880 584 606 SM00355 Zinc finger
ProfileScan IPR007087 136 163 PS50157 Zinc finger
IPR007087 164 191 PS50157 Zinc finger
IPR007087 192 219 PS50157 Zinc finger
IPR007087 220 247 PS50157 Zinc finger
IPR007087 248 275 PS50157 Zinc finger
IPR007087 276 303 PS50157 Zinc finger
IPR007087 304 331 PS50157 Zinc finger
IPR007087 332 359 PS50157 Zinc finger
IPR007087 360 387 PS50157 Zinc finger
IPR007087 388 415 PS50157 Zinc finger
IPR007087 416 443 PS50157 Zinc finger
IPR007087 444 471 PS50157 Zinc finger
IPR007087 472 499 PS50157 Zinc finger
IPR007087 500 527 PS50157 Zinc finger
IPR007087 528 555 PS50157 Zinc finger
IPR007087 556 583 PS50157 Zinc finger
IPR007087 584 608 PS50157 Zinc finger
ScanRegExp IPR007087 32 52 PS00028 Zinc finger
IPR007087 138 158 PS00028 Zinc finger
IPR007087 166 186 PS00028 Zinc finger
IPR007087 194 214 PS00028 Zinc finger
IPR007087 222 242 PS00028 Zinc finger
IPR007087 250 270 PS00028 Zinc finger
IPR007087 278 298 PS00028 Zinc finger
IPR007087 306 326 PS00028 Zinc finger
IPR007087 334 354 PS00028 Zinc finger
IPR007087 362 382 PS00028 Zinc finger
IPR007087 390 410 PS00028 Zinc finger
IPR007087 418 438 PS00028 Zinc finger
IPR007087 446 466 PS00028 Zinc finger
IPR007087 474 494 PS00028 Zinc finger
IPR007087 502 522 PS00028 Zinc finger
IPR007087 530 550 PS00028 Zinc finger
IPR007087 558 578 PS00028 Zinc finger
IPR007087 586 606 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGTCCGGGTACCTCATATAAG
Primer_r ATAACACTTTTCTCAGGACAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp