Order Kazusa clone(s) from : ![]() |
Product ID | ORK00942 |
---|---|
Accession No | AB067479 |
Description | DDB1 and CUL4 associated factor 12 |
Clone name | fk04164 |
Vector information | |
cDNA sequence | DNA sequence (3591 bp) Predicted protein sequence (476 aa) |
HaloTag ORF Clone |
FHC00942
![]() |
Flexi ORF Clone | FXC00942 |
Source | Human fetal brain |
Rouge ID |
mKIAA1892
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1967 bp |
---|---|
Genome contig ID | gi89161216r_33976411 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99975 - 99926) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 34076386 | 34116691 | 9 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 196 | 234 | PF00400 | WD40 repeat |
HMMSmart | IPR001680 | 100 | 139 | SM00320 | WD40 repeat |
IPR001680 | 195 | 234 | SM00320 | WD40 repeat | |
IPR001680 | 259 | 303 | SM00320 | WD40 repeat | |
IPR001680 | 351 | 389 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 203 | 243 | PS50082 | WD40 repeat |
IPR001680 | 203 | 243 | PS50294 | WD40 repeat | |
ScanRegExp | IPR001680 | 221 | 235 | PS00678 | WD40 repeat |
![]() |
Primer_f | CTCTGCTTTTCTGTCAACATC |
---|---|
Primer_r | CTGTGGTATGTGCTGTGTAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |