Gene/Protein Characteristic Table for KIAA1776
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01697
Accession No AB053450
Description fibrillin 3
Clone name fh11044s3
Vector information
The cDNA fragment was inserted at ApaI-NotI site of the pBlu ...
cDNA sequence DNA sequence (8966 bp)
Predicted protein sequence (2816 aa)
Flexi ORF Clone FXC01697
Source Human fetal brain
Note We replaced fh11044x1, former representative clones for KIAA1776 with fh11044s3. (2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 8966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 515 bp
Genome contig ID gi42406306r_7936288
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
CAAAAGTGGAGACGATAATAAAGTTATTTTGGGTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAGTCTGCCTGCCCTTTGGCAAGTTCTTGAAGTAAGTAGATGCTGCCCTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 8036288 8118385 63 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 2816 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB47408 0 100.0 fibrillin3 [Hom...
 Homo sapiens
AAI53883 0 100.0 Fibrillin 3 [Ho...
 Homo sapiens
Q75N90 0 99.9 Fibrillin-3; Fl...
 Homo sapiens
NP_115823 0 99.9 fibrillin 3 pre...
 Homo sapiens
BAD16733 0 99.9 fibrillin 3 [Ho...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011539 1.4e-42 28.8 KIAA0815
AB058677 2.3e-20 28.5 KIAA1781
D87433 2e-16 23.5 KIAA0246
AB058676 3.7e-16 27.1 KIAA1780
AB011537 8.8e-14 22.9 KIAA0813
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006209 127 153 PF00008 EGF-like
IPR002212 201 243 PF00683 Matrix fibril-associated
IPR013091 254 294 PF07645 EGF calcium-binding
IPR002212 309 352 PF00683 Matrix fibril-associated
IPR006209 419 449 PF00008 EGF-like
IPR013091 456 494 PF07645 EGF calcium-binding
IPR013091 496 536 PF07645 EGF calcium-binding
IPR013091 538 577 PF07645 EGF calcium-binding
IPR013091 579 618 PF07645 EGF calcium-binding
IPR002212 634 676 PF00683 Matrix fibril-associated
IPR013091 689 729 PF07645 EGF calcium-binding
IPR013091 731 771 PF07645 EGF calcium-binding
IPR013091 773 811 PF07645 EGF calcium-binding
IPR002212 826 865 PF00683 Matrix fibril-associated
IPR013091 876 916 PF07645 EGF calcium-binding
IPR002212 931 972 PF00683 Matrix fibril-associated
IPR013091 993 1033 PF07645 EGF calcium-binding
IPR013091 1035 1076 PF07645 EGF calcium-binding
IPR013091 1078 1118 PF07645 EGF calcium-binding
IPR013091 1120 1160 PF07645 EGF calcium-binding
IPR013091 1162 1201 PF07645 EGF calcium-binding
IPR013091 1203 1243 PF07645 EGF calcium-binding
IPR013091 1245 1285 PF07645 EGF calcium-binding
IPR013091 1287 1326 PF07645 EGF calcium-binding
IPR013091 1328 1367 PF07645 EGF calcium-binding
IPR013091 1369 1409 PF07645 EGF calcium-binding
IPR013091 1411 1450 PF07645 EGF calcium-binding
IPR013091 1452 1499 PF07645 EGF calcium-binding
IPR002212 1511 1552 PF00683 Matrix fibril-associated
IPR013091 1570 1610 PF07645 EGF calcium-binding
IPR002212 1666 1709 PF00683 Matrix fibril-associated
IPR013091 1728 1768 PF07645 EGF calcium-binding
IPR013091 1770 1810 PF07645 EGF calcium-binding
IPR013091 1814 1852 PF07645 EGF calcium-binding
IPR013091 1854 1891 PF07645 EGF calcium-binding
IPR013091 1893 1934 PF07645 EGF calcium-binding
IPR013091 1936 1974 PF07645 EGF calcium-binding
IPR013091 1976 2016 PF07645 EGF calcium-binding
IPR002212 2031 2074 PF00683 Matrix fibril-associated
IPR013091 2091 2131 PF07645 EGF calcium-binding
IPR013091 2133 2171 PF07645 EGF calcium-binding
IPR013091 2173 2212 PF07645 EGF calcium-binding
IPR013091 2214 2257 PF07645 EGF calcium-binding
IPR013091 2259 2299 PF07645 EGF calcium-binding
IPR002212 2314 2357 PF00683 Matrix fibril-associated
IPR013091 2370 2410 PF07645 EGF calcium-binding
IPR013091 2412 2451 PF07645 EGF calcium-binding
IPR013091 2453 2490 PF07645 EGF calcium-binding
IPR006209 2496 2533 PF00008 EGF-like
IPR013091 2535 2573 PF07645 EGF calcium-binding
IPR013091 2575 2615 PF07645 EGF calcium-binding
IPR013091 2617 2655 PF07645 EGF calcium-binding
HMMSmart IPR006210 92 120 SM00181 EGF
IPR006210 126 154 SM00181 EGF
IPR006210 157 186 SM00181 EGF
IPR001881 254 295 SM00179 EGF-like calcium-binding
IPR006210 257 295 SM00181 EGF
IPR001881 417 455 SM00179 EGF-like calcium-binding
IPR006210 418 455 SM00181 EGF
IPR001881 456 495 SM00179 EGF-like calcium-binding
IPR006210 459 495 SM00181 EGF
IPR001881 496 537 SM00179 EGF-like calcium-binding
IPR006210 499 537 SM00181 EGF
IPR001881 538 578 SM00179 EGF-like calcium-binding
IPR006210 541 578 SM00181 EGF
IPR001881 579 619 SM00179 EGF-like calcium-binding
IPR006210 582 619 SM00181 EGF
IPR001881 689 730 SM00179 EGF-like calcium-binding
IPR006210 692 730 SM00181 EGF
IPR001881 731 772 SM00179 EGF-like calcium-binding
IPR006210 734 772 SM00181 EGF
IPR001881 773 812 SM00179 EGF-like calcium-binding
IPR006210 776 812 SM00181 EGF
IPR001881 876 917 SM00179 EGF-like calcium-binding
IPR006210 879 917 SM00181 EGF
IPR001881 993 1034 SM00179 EGF-like calcium-binding
IPR006210 996 1034 SM00181 EGF
IPR001881 1035 1077 SM00179 EGF-like calcium-binding
IPR006210 1038 1077 SM00181 EGF
IPR001881 1078 1119 SM00179 EGF-like calcium-binding
IPR006210 1081 1119 SM00181 EGF
IPR001881 1120 1161 SM00179 EGF-like calcium-binding
IPR006210 1123 1161 SM00181 EGF
IPR001881 1162 1202 SM00179 EGF-like calcium-binding
IPR006210 1165 1202 SM00181 EGF
IPR001881 1203 1244 SM00179 EGF-like calcium-binding
IPR006210 1206 1244 SM00181 EGF
IPR001881 1245 1286 SM00179 EGF-like calcium-binding
IPR006210 1248 1286 SM00181 EGF
IPR001881 1287 1327 SM00179 EGF-like calcium-binding
IPR006210 1290 1327 SM00181 EGF
IPR001881 1328 1368 SM00179 EGF-like calcium-binding
IPR006210 1331 1368 SM00181 EGF
IPR001881 1369 1410 SM00179 EGF-like calcium-binding
IPR006210 1372 1410 SM00181 EGF
IPR001881 1411 1451 SM00179 EGF-like calcium-binding
IPR006210 1414 1451 SM00181 EGF
IPR001881 1452 1492 SM00179 EGF-like calcium-binding
IPR006210 1455 1492 SM00181 EGF
IPR001881 1570 1611 SM00179 EGF-like calcium-binding
IPR006210 1573 1611 SM00181 EGF
IPR001881 1612 1653 SM00179 EGF-like calcium-binding
IPR006210 1615 1653 SM00181 EGF
IPR001881 1728 1769 SM00179 EGF-like calcium-binding
IPR006210 1731 1769 SM00181 EGF
IPR001881 1770 1811 SM00179 EGF-like calcium-binding
IPR006210 1773 1811 SM00181 EGF
IPR001881 1814 1853 SM00179 EGF-like calcium-binding
IPR006210 1815 1853 SM00181 EGF
IPR001881 1854 1892 SM00179 EGF-like calcium-binding
IPR006210 1857 1892 SM00181 EGF
IPR001881 1893 1935 SM00179 EGF-like calcium-binding
IPR006210 1896 1935 SM00181 EGF
IPR001881 1936 1975 SM00179 EGF-like calcium-binding
IPR006210 1939 1975 SM00181 EGF
IPR001881 1976 2017 SM00179 EGF-like calcium-binding
IPR006210 1979 2017 SM00181 EGF
IPR001881 2091 2132 SM00179 EGF-like calcium-binding
IPR006210 2094 2132 SM00181 EGF
IPR001881 2133 2172 SM00179 EGF-like calcium-binding
IPR006210 2136 2172 SM00181 EGF
IPR001881 2173 2213 SM00179 EGF-like calcium-binding
IPR006210 2176 2213 SM00181 EGF
IPR001881 2214 2258 SM00179 EGF-like calcium-binding
IPR006210 2217 2258 SM00181 EGF
IPR001881 2259 2300 SM00179 EGF-like calcium-binding
IPR006210 2262 2300 SM00181 EGF
IPR001881 2370 2411 SM00179 EGF-like calcium-binding
IPR006210 2373 2411 SM00181 EGF
IPR001881 2412 2452 SM00179 EGF-like calcium-binding
IPR006210 2415 2452 SM00181 EGF
IPR001881 2453 2491 SM00179 EGF-like calcium-binding
IPR006210 2456 2491 SM00181 EGF
IPR001881 2492 2534 SM00179 EGF-like calcium-binding
IPR006210 2495 2534 SM00181 EGF
IPR001881 2535 2574 SM00179 EGF-like calcium-binding
IPR006210 2538 2574 SM00181 EGF
IPR001881 2575 2616 SM00179 EGF-like calcium-binding
IPR006210 2578 2616 SM00181 EGF
IPR001881 2617 2656 SM00179 EGF-like calcium-binding
IPR006210 2620 2656 SM00181 EGF
ProfileScan IPR000742 154 186 PS50026 EGF-like
IPR000742 254 291 PS50026 EGF-like
IPR000742 415 453 PS50026 EGF-like
IPR000742 456 495 PS50026 EGF-like
IPR000742 496 537 PS50026 EGF-like
IPR000742 538 578 PS50026 EGF-like
IPR000742 579 619 PS50026 EGF-like
IPR000742 689 730 PS50026 EGF-like
IPR000742 731 772 PS50026 EGF-like
IPR000742 773 812 PS50026 EGF-like
IPR000742 876 917 PS50026 EGF-like
IPR000742 993 1034 PS50026 EGF-like
IPR000742 1035 1077 PS50026 EGF-like
IPR000742 1078 1119 PS50026 EGF-like
IPR000742 1120 1161 PS50026 EGF-like
IPR000742 1162 1202 PS50026 EGF-like
IPR000742 1203 1244 PS50026 EGF-like
IPR000742 1245 1282 PS50026 EGF-like
IPR000742 1287 1325 PS50026 EGF-like
IPR000742 1328 1368 PS50026 EGF-like
IPR000742 1369 1410 PS50026 EGF-like
IPR000742 1411 1447 PS50026 EGF-like
IPR000742 1452 1492 PS50026 EGF-like
IPR000742 1570 1611 PS50026 EGF-like
IPR000742 1612 1653 PS50026 EGF-like
IPR000742 1728 1769 PS50026 EGF-like
IPR000742 1770 1811 PS50026 EGF-like
IPR000742 1812 1853 PS50026 EGF-like
IPR000742 1854 1889 PS50026 EGF-like
IPR000742 1893 1935 PS50026 EGF-like
IPR000742 1936 1975 PS50026 EGF-like
IPR000742 1976 2017 PS50026 EGF-like
IPR000742 2091 2132 PS50026 EGF-like
IPR000742 2133 2172 PS50026 EGF-like
IPR000742 2173 2213 PS50026 EGF-like
IPR000742 2214 2258 PS50026 EGF-like
IPR000742 2259 2300 PS50026 EGF-like
IPR000742 2370 2411 PS50026 EGF-like
IPR000742 2412 2452 PS50026 EGF-like
IPR000742 2453 2489 PS50026 EGF-like
IPR000742 2492 2534 PS50026 EGF-like
IPR000742 2535 2574 PS50026 EGF-like
IPR000742 2575 2612 PS50026 EGF-like
IPR000742 2617 2656 PS50026 EGF-like
ScanRegExp IPR013032 142 153 PS00022 EGF-like region
IPR013032 142 153 PS01186 EGF-like region
IPR013032 174 185 PS00022 EGF-like region
IPR013032 174 185 PS01186 EGF-like region
IPR001881 254 279 PS01187 EGF-like calcium-binding
IPR000152 270 281 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 440 454 PS01186 EGF-like region
IPR001881 456 479 PS01187 EGF-like calcium-binding
IPR000152 470 481 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 479 494 PS01186 EGF-like region
IPR001881 496 521 PS01187 EGF-like calcium-binding
IPR000152 512 523 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 521 536 PS01186 EGF-like region
IPR001881 538 562 PS01187 EGF-like calcium-binding
IPR000152 553 564 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 562 577 PS01186 EGF-like region
IPR001881 579 603 PS01187 EGF-like calcium-binding
IPR000152 594 605 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 689 714 PS01187 EGF-like calcium-binding
IPR000152 705 716 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 714 729 PS01186 EGF-like region
IPR001881 731 756 PS01187 EGF-like calcium-binding
IPR000152 747 758 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 756 771 PS01186 EGF-like region
IPR001881 773 796 PS01187 EGF-like calcium-binding
IPR000152 787 798 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 876 901 PS01187 EGF-like calcium-binding
IPR000152 892 903 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 993 1018 PS01187 EGF-like calcium-binding
IPR000152 1009 1020 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1018 1033 PS01186 EGF-like region
IPR001881 1035 1060 PS01187 EGF-like calcium-binding
IPR000152 1051 1062 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 1078 1103 PS01187 EGF-like calcium-binding
IPR000152 1094 1105 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 1120 1145 PS01187 EGF-like calcium-binding
IPR000152 1136 1147 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1145 1160 PS01186 EGF-like region
IPR001881 1162 1186 PS01187 EGF-like calcium-binding
IPR000152 1177 1188 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1186 1201 PS01186 EGF-like region
IPR013032 1228 1243 PS01186 EGF-like region
IPR001881 1245 1270 PS01187 EGF-like calcium-binding
IPR000152 1261 1272 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1270 1285 PS01186 EGF-like region
IPR001881 1287 1313 PS01187 EGF-like calcium-binding
IPR000152 1304 1315 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1313 1326 PS01186 EGF-like region
IPR001881 1328 1354 PS01187 EGF-like calcium-binding
IPR000152 1345 1356 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1354 1367 PS01186 EGF-like region
IPR001881 1369 1394 PS01187 EGF-like calcium-binding
IPR000152 1385 1396 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1394 1409 PS01186 EGF-like region
IPR001881 1411 1435 PS01187 EGF-like calcium-binding
IPR000152 1426 1437 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1435 1450 PS01186 EGF-like region
IPR001881 1452 1476 PS01187 EGF-like calcium-binding
IPR000152 1467 1478 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 1570 1595 PS01187 EGF-like calcium-binding
IPR000152 1586 1597 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1595 1610 PS01186 EGF-like region
IPR001881 1612 1637 PS01187 EGF-like calcium-binding
IPR000152 1628 1639 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 1728 1753 PS01187 EGF-like calcium-binding
IPR000152 1744 1755 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1753 1768 PS01186 EGF-like region
IPR001881 1770 1796 PS01187 EGF-like calcium-binding
IPR000152 1787 1798 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1796 1810 PS01186 EGF-like region
IPR000152 1828 1839 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1837 1852 PS01186 EGF-like region
IPR001881 1854 1877 PS01187 EGF-like calcium-binding
IPR000152 1868 1879 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1877 1891 PS01186 EGF-like region
IPR001881 1893 1919 PS01187 EGF-like calcium-binding
IPR000152 1910 1921 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1919 1934 PS01186 EGF-like region
IPR001881 1936 1961 PS01187 EGF-like calcium-binding
IPR000152 1952 1963 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1961 1974 PS01186 EGF-like region
IPR001881 1976 2001 PS01187 EGF-like calcium-binding
IPR000152 1992 2003 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2001 2016 PS01186 EGF-like region
IPR001881 2091 2116 PS01187 EGF-like calcium-binding
IPR000152 2107 2118 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2116 2131 PS01186 EGF-like region
IPR001881 2133 2157 PS01187 EGF-like calcium-binding
IPR000152 2148 2159 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2157 2171 PS01186 EGF-like region
IPR001881 2173 2197 PS01187 EGF-like calcium-binding
IPR000152 2188 2199 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2197 2212 PS01186 EGF-like region
IPR001881 2214 2241 PS01187 EGF-like calcium-binding
IPR000152 2232 2243 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 2259 2284 PS01187 EGF-like calcium-binding
IPR000152 2275 2286 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2284 2299 PS01186 EGF-like region
IPR001881 2370 2395 PS01187 EGF-like calcium-binding
IPR000152 2386 2397 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2395 2410 PS01186 EGF-like region
IPR001881 2412 2436 PS01187 EGF-like calcium-binding
IPR000152 2427 2438 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2436 2451 PS01186 EGF-like region
IPR001881 2453 2477 PS01187 EGF-like calcium-binding
IPR000152 2468 2479 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2477 2490 PS01186 EGF-like region
IPR001881 2492 2518 PS01187 EGF-like calcium-binding
IPR000152 2509 2520 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2518 2533 PS01186 EGF-like region
IPR001881 2535 2558 PS01187 EGF-like calcium-binding
IPR000152 2549 2560 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2558 2573 PS01186 EGF-like region
IPR001881 2575 2600 PS01187 EGF-like calcium-binding
IPR000152 2591 2602 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2600 2615 PS01186 EGF-like region
IPR001881 2617 2641 PS01187 EGF-like calcium-binding
IPR000152 2632 2643 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 2641 2655 PS01186 EGF-like region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GAAATGCTACACGACAACCTC
Primer_r GAAGTGAAAGCCTGAGATTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name RH-map
Primer_f GAAATGCTACACGACAACCTC
Primer_r GAAGTGAAAGCCTGAGATTGG
PCR product length 194 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp