Order Kazusa clone(s) from : ![]() |
Product ID | ORK00861 |
---|---|
Accession No | AB046767 |
Description | transducin-like enhancer of split 3, transcript variant 3 |
Clone name | fh14154 |
Vector information | |
cDNA sequence | DNA sequence (5205 bp) Predicted protein sequence (863 aa) |
Flexi ORF Clone | FXC00861 |
Source | Human fetal brain |
Rouge ID |
mKIAA1547
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1821 bp |
---|---|
Genome contig ID | gi51511731r_68027670 |
PolyA signal sequence (AAGAAA,-15) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99999 - 99950) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 68127669 | 68177293 | 19 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001680 | 705 | 738 | PD000018 | WD40 repeat |
FPrintScan | IPR001680 | 682 | 696 | PR00320 | WD40 repeat |
IPR001680 | 724 | 738 | PR00320 | WD40 repeat | |
IPR009146 | 762 | 784 | PR01850 | Groucho/transducin-like enhancer | |
IPR009146 | 785 | 803 | PR01850 | Groucho/transducin-like enhancer | |
IPR009146 | 804 | 823 | PR01850 | Groucho/transducin-like enhancer | |
IPR001680 | 806 | 820 | PR00320 | WD40 repeat | |
IPR009146 | 824 | 843 | PR01850 | Groucho/transducin-like enhancer | |
IPR009146 | 844 | 863 | PR01850 | Groucho/transducin-like enhancer | |
HMMPfam | IPR005617 | 104 | 239 | PF03920 | Groucho/TLE |
IPR001680 | 568 | 604 | PF00400 | WD40 repeat | |
IPR001680 | 624 | 651 | PF00400 | WD40 repeat | |
IPR001680 | 657 | 695 | PF00400 | WD40 repeat | |
IPR001680 | 699 | 737 | PF00400 | WD40 repeat | |
IPR001680 | 781 | 819 | PF00400 | WD40 repeat | |
IPR001680 | 832 | 860 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 567 | 604 | SM00320 | WD40 repeat |
IPR001680 | 610 | 651 | SM00320 | WD40 repeat | |
IPR001680 | 656 | 695 | SM00320 | WD40 repeat | |
IPR001680 | 698 | 737 | SM00320 | WD40 repeat | |
IPR001680 | 740 | 778 | SM00320 | WD40 repeat | |
IPR001680 | 780 | 819 | SM00320 | WD40 repeat | |
IPR001680 | 820 | 860 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 573 | 746 | PS50294 | WD40 repeat |
IPR001680 | 663 | 704 | PS50082 | WD40 repeat | |
IPR001680 | 705 | 746 | PS50082 | WD40 repeat | |
IPR001680 | 787 | 863 | PS50294 | WD40 repeat | |
ScanRegExp | IPR001680 | 682 | 696 | PS00678 | WD40 repeat |
IPR001680 | 724 | 738 | PS00678 | WD40 repeat |
![]() |
Primer_f | CCAGCATATTCCAGTCTAAAG |
---|---|
Primer_r | GCTGGAGTTCTTGTTTAGTAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |