Order Kazusa clone(s) from : ![]() |
Product ID | ORK00807 |
---|---|
Accession No | AB037762 |
Description | myelin expression factor 2, transcript variant 1 |
Clone name | fj00303 |
Vector information | |
cDNA sequence | DNA sequence (4544 bp) Predicted protein sequence (620 aa) |
HaloTag ORF Clone |
FHC00807
![]() |
Flexi ORF Clone | FXC00807 |
Source | Human fetal brain |
Rouge ID |
mKIAA1341
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2679 bp |
---|---|
Genome contig ID | gi51511731r_46119719 |
PolyA signal sequence (CATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 46219719 | 46257788 | 16 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 122 | 193 | PF00076 | RNA recognition motif |
IPR000504 | 255 | 325 | PF00076 | RNA recognition motif | |
IPR000504 | 545 | 614 | PF00076 | RNA recognition motif | |
HMMSmart | IPR000504 | 121 | 194 | SM00360 | RNA recognition motif |
IPR000504 | 254 | 326 | SM00360 | RNA recognition motif | |
IPR000504 | 544 | 615 | SM00360 | RNA recognition motif | |
ProfileScan | IPR000504 | 120 | 198 | PS50102 | RNA recognition motif |
IPR000504 | 253 | 330 | PS50102 | RNA recognition motif | |
IPR000504 | 543 | 619 | PS50102 | RNA recognition motif |
![]() |
Primer_f | AGAAATTCAGTCAGTGTGGTC |
---|---|
Primer_r | CATTACGATCCAAGCGAACAT |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |