KIAA1321

Product ID	ORK00213
Accession No	AB037742
Description	nuclear fragile X mental retardation protein interacting protein 2
Clone name	fh13788
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5058 bp) Predicted protein sequence (714 aa)
HaloTag ORF Clone	FHC00213
Flexi ORF Clone	FXC00213
Source	Human fetal brain
Rouge ID	mKIAA1321 by Kazusa Mouse cDNA Project

Length: 5058 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2911 bp
Genome contig ID	gi51511734r_24512792
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TACAGAGCACTTATTAAAAAAAAATCTTAAGAGTT
Flanking genome sequence (99980 - 99931)	----+--------+--------+--------+--------+----* GATCTGTTTTCTGATTATTTTGTGTAAGCTTCTAAACAAACTTCAGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	24612772	24645262	4	99.7	Perfect prediction

Length: 714 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511374	99.7	82-kD FMRP Inte...	Pan troglodytes
Q7Z417	100.0	Nuclear fragile...	Homo sapiens
XP_001110992	99.0	similar to 82-k...	Macaca mulatta
XP_001918376	96.4	nuclear fragile...	Equus caballus
XP_001250303	95.3	similar to nucl...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CAGTATTTTGGGGGCATTAGG
Primer_r	AGTGCTCTGTAAGGAATTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 17

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CAGTATTTTGGGGGCATTAGG
Primer_r	AGTGCTCTGTAAGGAATTGTG
PCR product length	150 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles