KIAA1246

Product ID	ORK00779
Accession No	AB033072
Description	leucine rich repeat and fibronectin type III domain containing 2
Clone name	hh00149a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3144 bp) Predicted protein sequence (832 aa)
HaloTag ORF Clone	FHC00779
Flexi ORF Clone	FXC00779
Source	Human adult brain
Rouge ID	mKIAA1246 by Kazusa Mouse cDNA Project

Length: 3144 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	309 bp
Genome contig ID	gi89161210r_40367351
PolyA signal sequence (None)	+--------+--------+----*----+---- GTAGCCTACAAGCAAGCGGCTTTGGATTGCTTATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GGTCTAGTGTTGTTTTTATTTCTTAATTTATTTTTTTTCCATTTCCCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	40467351	40663104	3	99.9	Perfect prediction

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULH4	100.0	Leucine-rich re...	Homo sapiens
Q9BE71	99.4	Leucine-rich re...	Macaca fascicularis
XP_001114127	95.0	similar to leuc...	Macaca mulatta
XP_538906	95.9	similar to leuc...	Canis lupus fam...
EDM18946	95.3	leucine rich re...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040917	8.2e-43	47.7	KIAA1484
AB007876	3.6e-06	35.2	KIAA0416
AB014544	4.8e-06	32.6	KIAA0644
AB020725	7e-05	26.6	KIAA0918
AB018349	0.00015	25.8	KIAA0806

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	194	207	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	239	252	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	120	140	PF00560	Leucine-rich repeat
	IPR001611	144	166	PF00560	Leucine-rich repeat
	IPR001611	168	190	PF00560	Leucine-rich repeat
	IPR001611	193	215	PF00560	Leucine-rich repeat
	IPR001611	217	239	PF00560	Leucine-rich repeat
	IPR001611	241	263	PF00560	Leucine-rich repeat
	IPR013098	332	419	PF07679	Immunoglobulin I-set
	IPR003961	461	536	PF00041	Fibronectin
HMMSmart	IPR003591	118	141	SM00369	Leucine-rich repeat
	IPR003591	142	165	SM00369	Leucine-rich repeat
	IPR003591	166	189	SM00369	Leucine-rich repeat
	IPR003591	191	214	SM00369	Leucine-rich repeat
	IPR003591	215	238	SM00369	Leucine-rich repeat
	IPR003591	239	263	SM00369	Leucine-rich repeat
	IPR000483	285	330	SM00082	Cysteine-rich flanking region
	IPR003599	338	420	SM00409	Immunoglobulin subtype
	IPR003598	344	409	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	332	418	PS50835	Immunoglobulin-like
ProfileScan	IPR003961	461	553	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	574	GGTMILVIGGIIVATLLVFIVIL	596	PRIMARY	23

Primer_f	GGAAAGAATCTCACTGGCAAG
Primer_r	CCATTGACAGGGAGACGAAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGAAAGAATCTCACTGGCAAG
Primer_r	CCATTGACAGGGAGACGAAAC
PCR product length	85 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles