Order Kazusa clone(s) from : ![]() |
Product ID | ORK00733 |
---|---|
Accession No | AB029006 |
Description | spastin, transcript variant 2 |
Clone name | hj07423 |
Vector information | |
cDNA sequence | DNA sequence (5120 bp) Predicted protein sequence (584 aa) |
HaloTag ORF Clone |
FHC00733
![]() |
Flexi ORF Clone | FXC00733 |
Source | Human adult brain |
Rouge ID |
mKIAA1083
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3144 bp |
---|---|
Genome contig ID | gi89161199f_32042184 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (194027 - 194076) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 32142184 | 32236209 | 16 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003959 | 345 | 530 | PF00004 | AAA ATPase |
HMMSmart | IPR007330 | 116 | 194 | SM00745 | MIT |
IPR003593 | 342 | 478 | SM00382 | AAA+ ATPase | |
ScanRegExp | IPR003960 | 448 | 467 | PS00674 | AAA ATPase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 55 | YPLFVGFALLRLVAFHLGLLFVW | 77 | PRIMARY | 23 |
---|
![]() |
Primer_f | TCGGTGTTGAGCTCTGTGTTG |
---|---|
Primer_r | ACTCATTCTTTCCCTTGGCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCGGTGTTGAGCTCTGTGTTG |
Primer_r | ACTCATTCTTTCCCTTGGCTC |
PCR product length | 151 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |