KIAA0457

Product ID	ORK00541
Accession No	AB007926
Description	disrupted in schizophrenia 1, transcript variant Lv
Clone name	hg00693
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6833 bp) Predicted protein sequence (845 aa)
HaloTag ORF Clone	FHC00541
Flexi ORF Clone	FXC00541
Source	Human adult brain

Length: 6833 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4295 bp
Genome contig ID	gi89161185f_229729198
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTGTTATACAAAATAAAAGCTGATATCCAAGGC
Flanking genome sequence (514299 - 514348)	----+--------+--------+--------+--------+----* ATGGTGCATCTTGATGATTTTTTGTCCTTTGAAGTATGGATGATAGAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	229829198	230243495	13	99.8	Perfect prediction

Length: 845 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51226	100.0	Disrupted in sc...	Homo sapiens
NP_001012975	99.9	disrupted in sc...	Homo sapiens
CAH70954	99.8	disrupted in sc...	Homo sapiens
Q9NRI5	97.3	Disrupted in sc...	Homo sapiens
CAH70955	97.2	disrupted in sc...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CAAGAAAGTCAGCCCAGTGTC
Primer_r	TCAGACAGGCATCAACAAACC
PCR product length	108 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles