KIAA0309

Product ID	ORK01065
Accession No	AB002307
Description	Snf2-related CREBBP activator protein
Clone name	hg00096s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (10802 bp) Predicted protein sequence (3053 aa)
HaloTag ORF Clone	FHC01065
Flexi ORF Clone	FXC01065
Source	Human adult brain
Note	We replaced hg00096, former representative clones for KIAA0309 with hg00096s1. (2003/8/28)

Length: 10802 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1640 bp
Genome contig ID	gi51511732f_30522889
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATTCATTTTGTAATAAAAGCCTTTTTTAGTGGTG
Flanking genome sequence (140213 - 140262)	----+--------+--------+--------+--------+----* AAATACTCCTGTCTAATTGTTCTCCTCCTGCTTTCCCTTGGGCCCTTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	30622889	30663100	31	99.5	Perfect prediction

Length: 3053 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI59100	100.0	SRCAP protein [...	Homo sapiens
EAW52213	96.9	Snf2-related CB...	Homo sapiens
AAD39760	96.7	transcriptional...	Homo sapiens
NP_006653	95.0	Snf2-related CB...	Homo sapiens
Q6ZRS2	95.0	Helicase SRCAP;...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040931	1.1e-26	35.2	KIAA1498
AB033085	3.3e-09	45.1	KIAA1259
AB007913	7.1e-07	33.6	KIAA0444
AB032948	3.6e-06	29.5	KIAA1122
AB046784	6.6e-06	27.5	KIAA1564

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	2680	2690	PR00929	HMG-I and HMG-Y
	IPR000637	2757	2768	PR00929	HMG-I and HMG-Y
	IPR000637	2825	2835	PR00929	HMG-I and HMG-Y
HMMPfam	IPR006562	106	177	PF07529	HSA
	IPR000330	602	888	PF00176	SNF2-related
	IPR001650	1901	1979	PF00271	DNA/RNA helicase
	IPR000637	2680	2692	PF02178	HMG-I and HMG-Y
	IPR000637	2759	2771	PF02178	HMG-I and HMG-Y
	IPR000637	2827	2839	PF02178	HMG-I and HMG-Y
HMMSmart	IPR013999	106	177	SM00573	HAS subgroup
	IPR014001	595	787	SM00487	DEAD-like helicases
	IPR001650	1896	1979	SM00490	DNA/RNA helicase
	IPR000637	2680	2692	SM00384	HMG-I and HMG-Y
	IPR000637	2759	2771	SM00384	HMG-I and HMG-Y
	IPR000637	2827	2839	SM00384	HMG-I and HMG-Y
ProfileScan	IPR014012	105	177	PS51204	Helicase/SANT-associated
	IPR014021	611	776	PS51192	Helicase
	IPR001650	1867	2020	PS51194	DNA/RNA helicase

Primer_f	TGCCCTCCTCTCATCAGTCTC
Primer_r	TGGTTGGAAGGATGGGGACTC
PCR conditions	95 °C15 sec64 °C15 sec72 °C45 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGCCCTCCTCTCATCAGTCTC
Primer_r	TGGTTGGAAGGATGGGGACTC
PCR product length	98 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles