ROUGE

Gene/Protein Characteristic Table for mKIAA0540

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129158
Description :
Clone Name :	mbg09815 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5065 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1987 bp

Genome contig ID gi65519420r_110566093
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GCCCATTCTCAGCAATAAACGTGGCCTAGTTTTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATCTTTCGGTTTCTTGAGTACACATGTGCCGCCGTCCTTGGCCTCCTGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0540 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0540	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3048, 3164..4735
Length: 1539 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI72118	100.0	Nbeal2 protein ...	Mus musculus
AAI57957	99.9	Nbeal2 protein ...	Mus musculus
Q6ZQA0	99.5	Neurobeachin-li...	Mus musculus
XP_982666	99.4	similar to FLJ0...	Mus musculus
XP_236649	94.9	similar to neur...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
Y18276	2.6e-53	33.9	mKIAA1544
AB093277	6.2e-16	33.2	mKIAA0993

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 865 1020 PD007848 NULL

HMMPfam IPR000409 850 1130 PF02138 Beige/BEACH

IPR001680 1278 1315 PF00400 WD-40 repeat

IPR001680 1329 1366 PF00400 WD-40 repeat

HMMSmart IPR001680 1228 1273 SM00320 WD-40 repeat

IPR001680 1276 1315 SM00320 WD-40 repeat

IPR001680 1327 1366 SM00320 WD-40 repeat

ProfileScan IPR000409 857 1130 PS50197 Beige/BEACH

IPR001680 1240 1375 PS50294 WD-40 repeat

IPR001680 1283 1324 PS50082 WD-40 repeat

IPR001680 1334 1375 PS50082 WD-40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	865	1020	PD007848	NULL
HMMPfam	IPR000409	850	1130	PF02138	Beige/BEACH
IPR001680	1278	1315	PF00400	WD-40 repeat
IPR001680	1329	1366	PF00400	WD-40 repeat
HMMSmart	IPR001680	1228	1273	SM00320	WD-40 repeat
IPR001680	1276	1315	SM00320	WD-40 repeat
IPR001680	1327	1366	SM00320	WD-40 repeat
ProfileScan	IPR000409	857	1130	PS50197	Beige/BEACH
IPR001680	1240	1375	PS50294	WD-40 repeat
IPR001680	1283	1324	PS50082	WD-40 repeat
IPR001680	1334	1375	PS50082	WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 15 37 LFVGTVPQVVSPDCLNLSDLLAV

1330 1352 PVQVLYGHVAAVSCVAISTELDM

Method	From	To	amino acid sequence
SOSUI	15	37	LFVGTVPQVVSPDCLNLSDLLAV
1330	1352	PVQVLYGHVAAVSCVAISTELDM

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1987 bp
Genome contig ID	gi65519420r_110566093
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GCCCATTCTCAGCAATAAACGTGGCCTAGTTTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCTTTCGGTTTCTTGAGTACACATGTGCCGCCGTCCTTGGCCTCCTGT

Gene/Protein Characteristic Table for mKIAA0540

Features of the cloned DNA sequence

Features of the protein sequence