Miyakogusa Predicted Gene

chr1.CM0295.260.nd
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr1.CM0295.260.nd
         (3233 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

BP064555  GENLf042d04                                                  70   3e-11
BP081774  MR075e01_f                                                   64   2e-09
KMC002112A_C01 KMC002112A_c01                                          60   3e-08

>BP064555  GENLf042d04;
          Length = 523

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 55/61 (90%), Gaps = 3/61 (4%)
 Strand = Plus / Minus

                                                                       
Query: 2   tttcttttcttcctatctctctcatcatttcacctctcttacacctcaaaagagaggtgt 61
           |||||||||||||||||||||||| |||| ||||||||   || ||||||||||||||||
Sbjct: 409 tttcttttcttcctatctctctcaccattccacctctc---catctcaaaagagaggtgt 353

            
Query: 62  g 62
           |
Sbjct: 352 g 352


>BP081774  MR075e01_f;
          Length = 332

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 1   ttttcttttcttcctatctctctcatcatttcacctctct 40
           ||||||||||||||||||||||||||||||  ||||||||
Sbjct: 180 ttttcttttcttcctatctctctcatcattctacctctct 219


>KMC002112A_C01 KMC002112A_c01;
          Length = 525

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 1   ttttcttttcttcctatctctctcatcatttcacctct 38
           |||||||||||||||||||||||| ||||| |||||||
Sbjct: 430 ttttcttttcttcctatctctctcctcattccacctct 467