Miyakogusa Predicted Gene

chr1.CM0178.110.nd
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr1.CM0178.110.nd
         (7115 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV420082  MWM177c01_r                                                  66   3e-10

>AV420082  MWM177c01_r;
          Length = 251

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                             
Query: 1873 agccggcctcacttagtgggacaaggcttttgttgttattgttgttgta 1921
            ||||| ||||||||||||||| |||||||||||| || |||||||||||
Sbjct: 103  agccgacctcacttagtgggataaggcttttgttattgttgttgttgta 151