Miyakogusa Predicted Gene

chr1.CM0088.100.nd
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr1.CM0088.100.nd
         (2441 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC004626A_C01 KMC004626A_c01                                          48   8e-05

>KMC004626A_C01 KMC004626A_c01;
          Length = 488

 Score = 48.1 bits (24), Expect = 8e-05
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 2297 tgaaaacatgtttggttgacatttagaaaatgttttcttataaaatat 2344
            |||||| |||||||||| |  ||| ||||||||||||||| |||||||
Sbjct: 106  tgaaaatatgtttggttaattttttgaaaatgttttcttagaaaatat 59