Miyakogusa Predicted Gene
- chr6.LjT36O06.80.nd
BLASTN 2.2.18 [Mar-02-2008]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr6.LjT36O06.80.nd
(4107 letters)
Database: lotus_5dash_unigene
7353 sequences; 3,026,947 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
R_KMC001771A_C01 R_KMC001771A_c01 44 6e-04
>R_KMC001771A_C01 R_KMC001771A_c01
Length = 422
Score = 44.1 bits (22), Expect = 6e-04
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 2223 atgactggtccagttgactttaataaggatatggacttttggcagcagga 2272
||||||||||||||||| ||||| ||| | |||| | ||||||||||||
Sbjct: 187 atgactggtccagttgattttaacaagagtctggagtattggcagcagga 236