Miyakogusa Predicted Gene

chr6.CM0420.270.nd
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr6.CM0420.270.nd
         (3776 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV412624  MWM221h12_r                                                  64   6e-10

>AV412624  MWM221h12_r;
          Length = 400

 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 2298 ttctaatatggtatcagagcctagcctagatccatt 2333
            ||||||||||||||||||||||| ||||||||||||
Sbjct: 332  ttctaatatggtatcagagcctatcctagatccatt 297