Miyakogusa Predicted Gene

chr5.CM0328.630.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr5.CM0328.630.nc
         (3404 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV410860  MWL079c10_r                                                  80   9e-15
R_KMC000219A_C01 R_KMC000219A_c01                                      56   1e-07
R_KMC001732A_C01 R_KMC001732A_c01                                      54   5e-07
R_KMC000446A_C01 R_KMC000446A_c01                                      46   1e-04

>AV410860  MWL079c10_r;
          Length = 110

 Score = 79.8 bits (40), Expect = 9e-15
 Identities = 43/44 (97%)
 Strand = Plus / Plus

                                                       
Query: 607 actcctccccccgctctcgcaacaccgactcatgggacgacccc 650
           |||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 67  actcctccccccgctcccgcaacaccgactcatgggacgacccc 110


>R_KMC000219A_C01 R_KMC000219A_c01
          Length = 856

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 873 ctcatctccgtcaccaccgacgaggacctcgagaatatgatcgatgagtacgatcg 928
           |||||||||||||||| |||||| ||||||||| |  ||||  |||||||||||||
Sbjct: 361 ctcatctccgtcaccaacgacgacgacctcgagcacttgatgcatgagtacgatcg 416


>R_KMC001732A_C01 R_KMC001732A_c01
          Length = 465

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 703 tcccccgccctcacgacaagtctctctgctacgtcggcggcgatacccgaatcgt 757
           |||||||||| ||||||||    ||| |||||||||||||||| |||||||||||
Sbjct: 223 tcccccgcccccacgacaatcagctccgctacgtcggcggcgacacccgaatcgt 277


>R_KMC000446A_C01 R_KMC000446A_c01
          Length = 846

 Score = 46.1 bits (23), Expect = 1e-04
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 861 gacctcgattctctcatctccgtcaccaccgacga 895
           ||||||||  |||||||||||||||||| ||||||
Sbjct: 372 gacctcgacgctctcatctccgtcaccaacgacga 406