Miyakogusa Predicted Gene

chr4.CM0256.180.nd
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr4.CM0256.180.nd
         (4017 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

R_KMC000255A_C01 R_KMC000255A_c01                                      48   4e-05
R_KMC000981A_C01 R_KMC000981A_c01                                      44   6e-04

>R_KMC000255A_C01 R_KMC000255A_c01
          Length = 471

 Score = 48.1 bits (24), Expect = 4e-05
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 272 catcacattcacattcacattcac 295
           ||||||||||||||||||||||||
Sbjct: 61  catcacattcacattcacattcac 84


>R_KMC000981A_C01 R_KMC000981A_c01
          Length = 561

 Score = 44.1 bits (22), Expect = 6e-04
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 275 cacattcacattcacattcaca 296
           ||||||||||||||||||||||
Sbjct: 119 cacattcacattcacattcaca 140