Miyakogusa Predicted Gene

chr4.CM0175.360.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr4.CM0175.360.nc
         (6434 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

R_KMC001266A_C01 R_KMC001266A_c01                                      58   7e-08
AV410718  MWL076e09_r                                                  44   0.001

>R_KMC001266A_C01 R_KMC001266A_c01
          Length = 587

 Score = 58.0 bits (29), Expect = 7e-08
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 1456 attctgacttttgaatcaattgtagaaggattt 1488
            ||||||||||| |||||||||||||||||||||
Sbjct: 367  attctgactttagaatcaattgtagaaggattt 335


>AV410718  MWL076e09_r;
          Length = 431

 Score = 44.1 bits (22), Expect = 0.001
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 1468 gaatcaattgtagaaggatttacaaa 1493
            ||||||||||||||| ||||||||||
Sbjct: 26   gaatcaattgtagaaagatttacaaa 1