Miyakogusa Predicted Gene

chr4.CM0170.10.nd
Show Alignment: 

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr4.CM0170.10.nd
         (5288 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV424967  MWM047h11_r                                                  66   2e-10

>AV424967  MWM047h11_r;
          Length = 344

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 3240 gagatatttactaccggtgttgtgcttggtagttacttggcaatgatgacagt 3292
            ||||||||| | |||||||||||||| ||||||||| ||||| ||||||||||
Sbjct: 13   gagatatttgcaaccggtgttgtgctaggtagttacatggcattgatgacagt 65