Miyakogusa Predicted Gene
- chr4.CM0170.10.nd
BLASTN 2.2.18 [Mar-02-2008]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr4.CM0170.10.nd
(5288 letters)
Database: lotus_5dash_unigene
7353 sequences; 3,026,947 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
AV424967 MWM047h11_r 66 2e-10
>AV424967 MWM047h11_r;
Length = 344
Score = 65.9 bits (33), Expect = 2e-10
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 3240 gagatatttactaccggtgttgtgcttggtagttacttggcaatgatgacagt 3292
||||||||| | |||||||||||||| ||||||||| ||||| ||||||||||
Sbjct: 13 gagatatttgcaaccggtgttgtgctaggtagttacatggcattgatgacagt 65