Miyakogusa Predicted Gene

chr4.CM0042.2210.nc
Show Alignment: 

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr4.CM0042.2210.nc
         (9127 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV407262  MWL020d06_r                                                 317   6e-86
AV424894  MWM046f09_r                                                  56   4e-07
R_KMC001266A_C01 R_KMC001266A_c01                                      54   1e-06
AV422086  MWM004d05_r                                                  52   6e-06

>AV407262  MWL020d06_r;
          Length = 221

 Score =  317 bits (160), Expect = 6e-86
 Identities = 160/160 (100%)
 Strand = Plus / Plus

                                                                        
Query: 3148 tggctgagtatatgggtggatcagttgaagatcctgaaagcatgtcaagagcatggcgta 3207
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    tggctgagtatatgggtggatcagttgaagatcctgaaagcatgtcaagagcatggcgta 60

                                                                        
Query: 3208 gtcttagctacagtctaaaagcgaccctcggtagcatggttttgccacttggttcactga 3267
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   gtcttagctacagtctaaaagcgaccctcggtagcatggttttgccacttggttcactga 120

                                                    
Query: 3268 ccattggattggctcgacatcgcgcattgttatttaaggt 3307
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 121  ccattggattggctcgacatcgcgcattgttatttaaggt 160



 Score =  129 bits (65), Expect = 3e-29
 Identities = 65/65 (100%)
 Strand = Plus / Plus

                                                                        
Query: 3483 aggtgttagctgatagtttgggcatcccatgtcggttggttaaaggactgcaatatacag 3542
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 157  aggtgttagctgatagtttgggcatcccatgtcggttggttaaaggactgcaatatacag 216

                 
Query: 3543 gtttg 3547
            |||||
Sbjct: 217  gtttg 221


>AV424894  MWM046f09_r;
          Length = 420

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 8280 aagcttctccccagaattgattctggcttcagaatcaatt 8319
            |||||| || ||||||||||||||||||| ||||||||||
Sbjct: 244  aagcttttcaccagaattgattctggctttagaatcaatt 205


>R_KMC001266A_C01 R_KMC001266A_c01
          Length = 587

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 8280 aagcttctccccagaattgattctggcttcagaatcaattgta 8322
            |||||||| | |||||||||||||| ||| |||||||||||||
Sbjct: 386  aagcttcttctcagaattgattctgactttagaatcaattgta 344


>AV422086  MWM004d05_r;
          Length = 461

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 8282 gcttctccccagaattgattctggcttcagaatc 8315
            ||||||| |||||||||||||| |||||||||||
Sbjct: 42   gcttctcaccagaattgattctcgcttcagaatc 9