Miyakogusa Predicted Gene

chr3.CM0127.630.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr3.CM0127.630.nc
         (7624 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV421861  MWM001a12_r                                                  52   5e-06
AV419799  MWM174b02_r                                                  50   2e-05

>AV421861  MWM001a12_r;
          Length = 455

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 3936 tgattctgggagaagctacttttagtagcttttgtggg 3973
            |||||||||||||||||| |  ||||||||||||||||
Sbjct: 91   tgattctgggagaagctattgatagtagcttttgtggg 128


>AV419799  MWM174b02_r;
          Length = 411

 Score = 50.1 bits (25), Expect = 2e-05
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 6598 tattcataagctaatttgataagcttatagaaataag 6634
            ||||||||||||||||||| ||||||||  |||||||
Sbjct: 73   tattcataagctaatttgagaagcttattcaaataag 37