Miyakogusa Predicted Gene

chr3.CM0091.630.nd

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr3.CM0091.630.nd
         (1771 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV410311  MWL070g09_r                                                 119   6e-27

>AV410311  MWL070g09_r;
          Length = 369

 Score =  119 bits (60), Expect = 6e-27
 Identities = 129/152 (84%)
 Strand = Plus / Plus

                                                                        
Query: 895  aggttgtgaacgatcgtgagactggaagatctaggggattcggattcgtgacgttcgcgt 954
            ||||||| |||||||||||||||||||| || |||||||| ||||||||||| ||| | |
Sbjct: 137  aggttgtcaacgatcgtgagactggaaggtcaaggggatttggattcgtgaccttcactt 196

                                                                        
Query: 955  cggagcagtcgatgaaggatgcgatcgaggggatgaacggccaggacattgacggccgta 1014
            | ||| || | |||| |   ||||||||||||||||||||| | ||  ||||||||||||
Sbjct: 197  ctgaggaggctatgaggagcgcgatcgaggggatgaacggcaatgagcttgacggccgta 256

                                            
Query: 1015 atgttaccgtgaatgaagcccaggctcgcggc 1046
            |  | || ||||||||||||||||||||||||
Sbjct: 257  acatcactgtgaatgaagcccaggctcgcggc 288



 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 513 gatgttgagtaccgttgcttcgttggtgggctcgcctgggccac 556
           ||||||||||||||||||||||| ||||| || |||||| ||||
Sbjct: 37  gatgttgagtaccgttgcttcgtcggtggtcttgcctggaccac 80