Miyakogusa Predicted Gene

chr2.LjT41P23.50.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr2.LjT41P23.50.nc
         (7382 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV408948  MWL049d03_r                                                 125   4e-28

>AV408948  MWL049d03_r;
          Length = 336

 Score =  125 bits (63), Expect = 4e-28
 Identities = 63/63 (100%)
 Strand = Plus / Plus

                                                                       
Query: 458 gaatggtctagtgtatggctttgtaagatattgatataaaagtatgggcagcagtgagat 517
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 274 gaatggtctagtgtatggctttgtaagatattgatataaaagtatgggcagcagtgagat 333

              
Query: 518 gga 520
           |||
Sbjct: 334 gga 336