Miyakogusa Predicted Gene

chr2.LjT16L14.40.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr2.LjT16L14.40.nc
         (4079 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV407419  MWL023a11_r                                                  44   6e-04

>AV407419  MWL023a11_r;
          Length = 429

 Score = 44.1 bits (22), Expect = 6e-04
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 797 ttgattttgattttgattttga 818
           ||||||||||||||||||||||
Sbjct: 303 ttgattttgattttgattttga 282



 Score = 44.1 bits (22), Expect = 6e-04
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 797 ttgattttgattttgattttga 818
           ||||||||||||||||||||||
Sbjct: 309 ttgattttgattttgattttga 288