Miyakogusa Predicted Gene
- chr2.CM0168.280.nc
BLASTN 2.2.18 [Mar-02-2008]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr2.CM0168.280.nc
(4546 letters)
Database: lotus_5dash_unigene
7353 sequences; 3,026,947 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
AV427213 MWM077h11_r 127 6e-29
>AV427213 MWM077h11_r;
Length = 418
Score = 127 bits (64), Expect = 6e-29
Identities = 73/76 (96%)
Strand = Plus / Plus
Query: 808 ggtaaacatcctgttaccggaactccgttgaagcagcaggatctcattccactcaatttc 867
|||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||
Sbjct: 3 ggtaaacatcctgtcaccggagctccgttgaagcagcaggatctcattcctctcaatttc 62
Query: 868 cacaagaattcagaag 883
||||||||||||||||
Sbjct: 63 cacaagaattcagaag 78