Miyakogusa Predicted Gene

chr2.CM0081.330.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr2.CM0081.330.nc
         (8511 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV415593  MWM113d03_r                                                  58   9e-08

>AV415593  MWM113d03_r;
          Length = 416

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 7541 taaggctgagagtgaaggtgaagctgaggggatgtgtgatgccca 7585
            ||||||||||||||||||||||||||| || |||  |||||||||
Sbjct: 128  taaggctgagagtgaaggtgaagctgaaggaatggttgatgccca 172