Miyakogusa Predicted Gene

chr1.CM0133.1540.nc
Show Alignment: 
BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr1.CM0133.1540.nc
         (5092 letters)

Database: lotus_5dash_unigene 
           7353 sequences; 3,026,947 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV419799  MWM174b02_r                                                  44   8e-04
AV413939  MWM238h02_r                                                  44   8e-04

>AV419799  MWM174b02_r;
          Length = 411

 Score = 44.1 bits (22), Expect = 8e-04
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 2392 ttctcaaattagcttatgaata 2413
            ||||||||||||||||||||||
Sbjct: 52   ttctcaaattagcttatgaata 73


>AV413939  MWM238h02_r;
          Length = 286

 Score = 44.1 bits (22), Expect = 8e-04
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 1132 gccccatttggaagaccttattttagcttatcttatag 1169
            |||||||||||||||  |||||| |||||| |||||||
Sbjct: 110  gccccatttggaagagtttatttaagcttaacttatag 73