Miyakogusa Predicted Gene

chr5.LjT15N12.20.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr5.LjT15N12.20.nc
         (3144 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

BP055418  SPDL054e12_f                                                 46   4e-04

>BP055418  SPDL054e12_f;
          Length = 526

 Score = 46.1 bits (23), Expect = 4e-04
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 1656 aggaggacgaagatgaggatgaagatgaaga 1686
            ||||||| |||||||| ||||||||||||||
Sbjct: 46   aggaggaagaagatgaagatgaagatgaaga 16