Miyakogusa Predicted Gene

chr5.LjT02I10.320.nd
Show Alignment: 

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr5.LjT02I10.320.nd
         (5330 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV772572  MPD038a11_f                                                 115   9e-25
BP072944  GNf075g12                                                   113   4e-24
KMC005282A_C02 KMC005282A_c02                                          78   2e-13
AV777755  MPDL025d08_f                                                 58   2e-07
BP071590  GNf057b01                                                    54   3e-06

>AV772572  MPD038a11_f;
          Length = 491

 Score =  115 bits (58), Expect = 9e-25
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                        
Query: 1392 ggtgagaagaagtggaagtgtgacaagtgctccaagaaatatgctgttcaatctgattgg 1451
            ||||||||||||||||||||||| ||||||||||||||||| || || | ||| ||||||
Sbjct: 234  ggtgagaagaagtggaagtgtgagaagtgctccaagaaatacgcagtcccatcagattgg 175

                                                                        
Query: 1452 aaagctcattctaagacttgtggcaccagggaatacagatgtgactgtggcactctcttc 1511
            ||||||||  |  | || || ||||||||||| ||||  |||||||||||||| ||||||
Sbjct: 174  aaagctcacacccaaacatgcggcaccagggagtacaagtgtgactgtggcaccctcttc 115

                  
Query: 1512 tccagg 1517
            ||||||
Sbjct: 114  tccagg 109


>BP072944  GNf075g12;
          Length = 158

 Score =  113 bits (57), Expect = 4e-24
 Identities = 108/119 (90%), Gaps = 7/119 (5%)
 Strand = Plus / Plus

                                                                       
Query: 78  tgccttgtgtatatgtgttgg-tgtatctgcatgacaccgaatcactag-tgaagaaact 135
           ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||
Sbjct: 28  tgccttgtgtatatgtgttgggtgtatctgcatgacaccgaatcactagatgaagaaact 87

                                                                      
Query: 136 ctgttg--tggtgatgttattattttccc--ttcctcaaatttc-ttctcatttataac 189
           ||| ||   ||||||||||||||||||||   |||||||||||| || |||||||||||
Sbjct: 88  ctggtggtgggtgatgttattattttcccctatcctcaaatttctttttcatttataac 146


>KMC005282A_C02 KMC005282A_c02;
          Length = 700

 Score = 77.8 bits (39), Expect = 2e-13
 Identities = 76/86 (88%), Gaps = 3/86 (3%)
 Strand = Plus / Minus

                                                                        
Query: 5207 attgctggcaataggcaagctgcggccctttcgattccgagggtggctttactattgccc 5266
            |||||| |||||||||||||||||||||||| ||||| |||| | ||||||||| | |||
Sbjct: 620  attgctcgcaataggcaagctgcggcccttttgattcagaggct-gctttactacttccc 562

                                      
Query: 5267 tccaaattccaggatgacctcaacag 5292
            |||||||||   ||||||||||||||
Sbjct: 561  tccaaattc--agatgacctcaacag 538


>AV777755  MPDL025d08_f;
          Length = 401

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1117 cagatccagatgcagaggtgatagcactatctcccaagaccctaatggcaacaaacaggt 1176
            |||||||||||||||||||||| || || || || |||||||| ||||| || ||||| |
Sbjct: 181  cagatccagatgcagaggtgattgctctgtcaccgaagaccctgatggcgacgaacagat 240

                                                 
Query: 1177 tcatatgtgaggtgtgcaacaaagggttccaaaggga 1213
            |  |||||||  | |||||||| ||||| || |||||
Sbjct: 241  ttgtatgtgaaatatgcaacaaggggtttcagaggga 277


>BP071590  GNf057b01;
          Length = 410

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 2063 ttgactctgacttcagaatcaattattgaaactttttcaaacatgca 2109
            |||| |||||||| |||||||||| ||||||  ||||||||||||||
Sbjct: 67   ttgattctgactttagaatcaattgttgaaagattttcaaacatgca 21