Miyakogusa Predicted Gene

chr5.CM0328.630.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr5.CM0328.630.nc
         (3404 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC003820A_C01 KMC003820A_c01                                          56   5e-07
BP071242  GNf052e07                                                    54   2e-06
KMC002777A_C01 KMC002777A_c01                                          50   3e-05
BP056681  SPDL076a07_f                                                 46   4e-04

>KMC003820A_C01 KMC003820A_c01;
          Length = 548

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 873 ctcatctccgtcaccaccgacgaggacctcgagaatatgatcgatgagtacgatcg 928
           |||||||||||||||| |||||| ||||||||| |  ||||  |||||||||||||
Sbjct: 358 ctcatctccgtcaccaacgacgacgacctcgagcacttgatgcatgagtacgatcg 413


>BP071242  GNf052e07;
          Length = 490

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 703 tcccccgccctcacgacaagtctctctgctacgtcggcggcgatacccgaatcgt 757
           |||||||||| ||||||||    ||| |||||||||||||||| |||||||||||
Sbjct: 244 tcccccgcccccacgacaatcagctccgctacgtcggcggcgacacccgaatcgt 298


>KMC002777A_C01 KMC002777A_c01;
          Length = 519

 Score = 50.1 bits (25), Expect = 3e-05
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 2020 cctgtgatctatcaagagcaagttctgattcaatctggaac 2060
            ||||| ||||||||||| |||||||  ||||||||||||||
Sbjct: 199  cctgtaatctatcaagaccaagttcaaattcaatctggaac 239


>BP056681  SPDL076a07_f;
          Length = 567

 Score = 46.1 bits (23), Expect = 4e-04
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 861 gacctcgattctctcatctccgtcaccaccgacga 895
           ||||||||  |||||||||||||||||| ||||||
Sbjct: 354 gacctcgacgctctcatctccgtcaccaacgacga 388