Miyakogusa Predicted Gene

chr4.CM0333.280.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr4.CM0333.280.nc
         (5777 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

BP070676  GNf045c09                                                    84   3e-15
KMC005436A_C01 KMC005436A_c01                                          70   5e-11

>BP070676  GNf045c09;
          Length = 420

 Score = 83.8 bits (42), Expect = 3e-15
 Identities = 69/78 (88%)
 Strand = Plus / Plus

                                                                        
Query: 3484 tgcatgaatggcattttcgctcagggcttgatcgctacatatggataataggaatgattt 3543
            ||||||| ||||||||  | || |||||||||||||||||||||||||| ||||||||||
Sbjct: 38   tgcatgagtggcatttcagatctgggcttgatcgctacatatggataattggaatgattt 97

                              
Query: 3544 atgcttattatcatccaa 3561
            |||| || | ||||||||
Sbjct: 98   atgcctactttcatccaa 115


>KMC005436A_C01 KMC005436A_c01;
          Length = 866

 Score = 69.9 bits (35), Expect = 5e-11
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                        
Query: 2478 atcatagtttcagctgtgacttcctttaagatacataatgacaagtcaccattttctggg 2537
            ||||||||||||||  ||||||| || || | ||||| ||||   ||  |||||||||| 
Sbjct: 706  atcatagtttcagcaatgacttctttgaaaaaacatactgactcatcggcattttctgga 765

                                                                       
Query: 2538 aaatccatactttacttaaatcggcatcagactgaagaatggaaaggctggatgcaggt 2596
            | |  |||||||||| | ||||||||||| || |||||||||||||| |||||||||||
Sbjct: 766  agaagcatactttaccttaatcggcatcaaacagaagaatggaaaggatggatgcaggt 824