Miyakogusa Predicted Gene

chr4.CM0170.10.nd
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr4.CM0170.10.nd
         (5288 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC000505A_C01 KMC000505A_c01                                         123   4e-27
KMC004903A_C01 KMC004903A_c01                                          50   4e-05
KMC003089A_C01 KMC003089A_c01                                          46   7e-04

>KMC000505A_C01 KMC000505A_c01;
          Length = 661

 Score =  123 bits (62), Expect = 4e-27
 Identities = 130/153 (84%)
 Strand = Plus / Minus

                                                                        
Query: 3868 tggagttttgctgcaattgaaggaataggttggggttgggctggtgtaatatggttatat 3927
            |||||||||||||| |||||||| || || |||| ||||||||||||  | ||| | |||
Sbjct: 657  tggagttttgctgctattgaagggattggatgggnttgggctggtgttgtttggctttat 598

                                                                        
Query: 3928 aacataatcttctacatcccccttgatttcatcaagtttttaacccgctatgctttgagt 3987
            ||| | |||||||| ||||| |||||||||||||||||  | || || ||||| ||||||
Sbjct: 597  aacctcatcttctatatcccacttgatttcatcaagttcattactcgatatgccttgagt 538

                                             
Query: 3988 ggaagagcttgggatcttgttattgagcaaagg 4020
            || || |||||||||||||||||||| ||||||
Sbjct: 537  ggcagggcttgggatcttgttattgaacaaagg 505



 Score = 65.9 bits (33), Expect = 7e-10
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                        
Query: 4697 tgagagaacttcatacactgaaaggtcatgtagaatcagttgtgaggttgaaggggctcg 4756
            |||||||||| ||||| ||||| || ||||| || ||||| || ||| ||||||| || |
Sbjct: 323  tgagagaactgcatactctgaagggccatgttgagtcagtggttaggctgaagggacttg 264

                                             
Query: 4757 acatagacacaattcagcaagcatacacagtct 4789
            |||| ||||| || |||||||||||||| ||||
Sbjct: 263  acattgacaccatacagcaagcatacactgtct 231


>KMC004903A_C01 KMC004903A_c01;
          Length = 347

 Score = 50.1 bits (25), Expect = 4e-05
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 3022 tttccaccttttatggtgctgattattgccatcctaaatgatggt 3066
            |||||||| || ||||| ||||| ||||| |||||||||||||||
Sbjct: 246  tttccacccttcatggtcctgatcattgcaatcctaaatgatggt 290


>KMC003089A_C01 KMC003089A_c01;
          Length = 1003

 Score = 46.1 bits (23), Expect = 7e-04
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 176 tttatcagaatcaattctgaaactgagaaactatt 210
           ||||| |||||||||||||||||| |||| |||||
Sbjct: 905 tttataagaatcaattctgaaactcagaagctatt 871