Miyakogusa Predicted Gene

chr3.LjT23E22.10.nd
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr3.LjT23E22.10.nd
         (8115 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

BP074097  GNf091e12                                                    66   1e-09
KMC000859A_C01 KMC000859A_c01                                          58   3e-07
BP063161  GENLf015f01                                                  52   2e-05

>BP074097  GNf091e12;
          Length = 388

 Score = 65.9 bits (33), Expect = 1e-09
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 6915 acttgaacccgtgacctcagtcacatggaaacaactttttatggttgcgccaa 6967
            |||||||| ||||||||||||||||| | ||||||||||||  ||||||||||
Sbjct: 219  acttgaactcgtgacctcagtcacattgcaacaactttttaccgttgcgccaa 271


>KMC000859A_C01 KMC000859A_c01;
          Length = 656

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 61/69 (88%), Gaps = 2/69 (2%)
 Strand = Plus / Plus

                                                                        
Query: 5418 tagggacccaatttgatggaaaatttttacaaggaccagggtt-gattccctttacaatt 5476
            |||||||||||||||||| |||| |||| | ||| || || || ||||||||||||||||
Sbjct: 146  tagggacccaatttgatgcaaaaatttt-ctaggccctggatttgattccctttacaatt 204

                     
Query: 5477 acaggggcc 5485
            |||||||||
Sbjct: 205  acaggggcc 213



 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 3307 ggcccctgtaattgtaaagggaatcaa 3333
            |||||||||||||||||||||||||||
Sbjct: 213  ggcccctgtaattgtaaagggaatcaa 187


>BP063161  GENLf015f01;
          Length = 477

 Score = 52.0 bits (26), Expect = 2e-05
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 3290 ggcttaaatgctcaattggcccctgtaattgtaaaggg 3327
            |||||||||| || |||||||||||||||| |||||||
Sbjct: 38   ggcttaaatggtccattggcccctgtaattataaaggg 1



 Score = 52.0 bits (26), Expect = 2e-05
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 5465 ccctttacaattacaggggccaattgagcatttaagcc 5502
            ||||||| |||||||||||||||| || ||||||||||
Sbjct: 1    ccctttataattacaggggccaatggaccatttaagcc 38