Miyakogusa Predicted Gene

chr3.CM0246.220.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr3.CM0246.220.nc
         (14,615 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

BP074540  GNf097c01                                                   113   1e-23
KMC002720A_C01 KMC002720A_c01                                          50   1e-04

>BP074540  GNf097c01;
          Length = 144

 Score =  113 bits (57), Expect = 1e-23
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                        
Query: 5201 ccttgatttcggaccaagtctaagggaaatttgtgcagcaaatagatctgatgaaaagca 5260
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 103  ccttgatttcggaccaagcctaagggaaatttgtgcagcaaatagatctgatgaaaagca 44

             
Query: 5261 g 5261
            |
Sbjct: 43   g 43



 Score = 48.1 bits (24), Expect = 5e-04
 Identities = 38/40 (95%), Gaps = 2/40 (5%)
 Strand = Plus / Minus

                                                    
Query: 4831 aaagttttgaaagaatttcctcctccacctgctgatggag 4870
            ||||||||||||| |||||||||||| |||||||||||||
Sbjct: 144  aaagttttgaaag-atttcctcctcc-cctgctgatggag 107


>KMC002720A_C01 KMC002720A_c01;
          Length = 594

 Score = 50.1 bits (25), Expect = 1e-04
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 13536 cccgttttgatgcaaataaaaaagcttttattggaacttatttagtgcttttt 13588
             ||||||| ||||||||| |||||||  ||||| || |||||||||||| ||||
Sbjct: 286   cccgtttggatgcaaatcaaaaagcacttattagagcttatttagtgcatttt 234